Review



statistical software instat graphpad software version 3.0  (GraphPad Software Inc)


Bioz Verified Symbol GraphPad Software Inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    GraphPad Software Inc statistical software instat graphpad software version 3.0
    Statistical Software Instat Graphpad Software Version 3.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/instat+statistical+software+graphpad+instat+version+3%2E0/graphpad+prism+software/pm32323423-73-3-4
    Average 90 stars, based on 1 article reviews
    statistical software instat graphpad software version 3.0 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Software:

    Article Title: Estrogen selectively regulates chemokines in murine splenocytes.
    Article Snippet: Real-time PCR was carried out on an iCycler machine (BioRad, Hercules, CA, USA) programmed for 40 cycles of 95°C for 20 s, 58°C for 30 s, and 72°C for 45 s. Primers used were as follows: CCR1: 5 tcttctttatcatcctgttgacgattg 3 gagtaatagcaaatatcagacgcacgg; CCR2: 5 cattaccattctgggctcactatgctg 3 agcaaacacagcatgaacaatagcca; CCR3: 5 ctggtgttcatcatcggcctcct 3 ttcgggctcgaagggcaaac; CCR4: 5 caccaaggaaggtatcaaggcat 3 gctgtagaagcccaccaggtacatc; RANTES: 5 tcaccatatggctcggacacca 3 tgaacccacttcttctctgggttgg; -actin: 5 tggaatcctgtggcatccatgaaac 3 taaaacgcagctcagtaacagtccg; MCP-1: 5 tcatgcttctgggcctgctg 3 tctcatttggttccgatccaggtt; and MCP-5: 5 ccacacttctatgcctcctg 3 gctgcttgtgattctcctgt. .. Statistical analysis was performed using InStat statistical software (GraphPad InStat Version 3.0). ..



    Similar Products

    90
    GraphPad Software Inc statistical software instat graphpad software version 3.0
    Statistical Software Instat Graphpad Software Version 3.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/instat+statistical+software+graphpad+instat+version+3%2E0/graphpad+prism+software/pm32323423-73-3-4
    Average 90 stars, based on 1 article reviews
    statistical software instat graphpad software version 3.0 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    GraphPad Software Inc statistical analysis software graphpad instat version 3.0
    Statistical Analysis Software Graphpad Instat Version 3.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/instat+statistical+software+graphpad+instat+version+3%2E0/graphpad+prism+software/pm30259768-139-7-10
    Average 90 stars, based on 1 article reviews
    statistical analysis software graphpad instat version 3.0 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    GraphPad Software Inc statistical software graphpad instat version 3.0
    Statistical Software Graphpad Instat Version 3.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/instat+statistical+software+graphpad+instat+version+3%2E0/graphpad+prism+software/pmc04779503-184-6-5
    Average 90 stars, based on 1 article reviews
    statistical software graphpad instat version 3.0 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    GraphPad Software Inc computer statistical software package graphpad instat® version 3.0
    Computer Statistical Software Package Graphpad Instat® Version 3.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/instat+statistical+software+graphpad+instat+version+3%2E0/graphpad+prism+software/10__4314_slash_sokjvs__v14i3__6-58-5-4
    Average 90 stars, based on 1 article reviews
    computer statistical software package graphpad instat® version 3.0 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    GraphPad Software Inc statistic software graphpad instat version 3.0
    Statistic Software Graphpad Instat Version 3.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/instat+statistical+software+graphpad+instat+version+3%2E0/graphpad+prism+software/pm26962550-54-3-6
    Average 90 stars, based on 1 article reviews
    statistic software graphpad instat version 3.0 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    GraphPad Software Inc computer statistical software graphpad instat version 3.0
    Computer Statistical Software Graphpad Instat Version 3.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/instat+statistical+software+graphpad+instat+version+3%2E0/graphpad+prism+software/10__4314_slash_ari__v4i3__48688-69-23-25
    Average 90 stars, based on 1 article reviews
    computer statistical software graphpad instat version 3.0 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    GraphPad Software Inc instat statistical software graphpad instat version 3.0
    Instat Statistical Software Graphpad Instat Version 3.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/instat+statistical+software+graphpad+instat+version+3%2E0/graphpad+prism+software/pm17185357-79-5-8
    Average 90 stars, based on 1 article reviews
    instat statistical software graphpad instat version 3.0 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    GraphPad Software Inc statistical software package graphpad instat version 3.0
    Statistical Software Package Graphpad Instat Version 3.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/instat+statistical+software+graphpad+instat+version+3%2E0/graphpad+prism+software/pm16690799-119-30-36
    Average 90 stars, based on 1 article reviews
    statistical software package graphpad instat version 3.0 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results