statistical software instat graphpad software version 3.0 (GraphPad Software Inc)
GraphPad Software Inc is a verified supplier 
90
Structured Review
GraphPad Software Inc
statistical software instat graphpad software version 3.0
Statistical Software Instat Graphpad Software Version 3.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/instat+statistical+software+graphpad+instat+version+3%2E0/graphpad+prism+software/pm32323423-73-3-4
Average 90 stars, based on 1 article reviews
Statistical Software Instat Graphpad Software Version 3.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/instat+statistical+software+graphpad+instat+version+3%2E0/graphpad+prism+software/pm32323423-73-3-4
Average 90 stars, based on 1 article reviews
statistical software instat graphpad software version 3.0 - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Software:Article Title: Estrogen selectively regulates chemokines in murine splenocytes. Article Snippet: Real-time PCR was carried out on an iCycler machine (BioRad, Hercules, CA, USA) programmed for 40 cycles of 95°C for 20 s, 58°C for 30 s, and 72°C for 45 s. Primers used were as follows: CCR1: 5 tcttctttatcatcctgttgacgattg 3 gagtaatagcaaatatcagacgcacgg; CCR2: 5 cattaccattctgggctcactatgctg 3 agcaaacacagcatgaacaatagcca; CCR3: 5 ctggtgttcatcatcggcctcct 3 ttcgggctcgaagggcaaac; CCR4: 5 caccaaggaaggtatcaaggcat 3 gctgtagaagcccaccaggtacatc; RANTES: 5 tcaccatatggctcggacacca 3 tgaacccacttcttctctgggttgg; -actin: 5 tggaatcctgtggcatccatgaaac 3 taaaacgcagctcagtaacagtccg; MCP-1: 5 tcatgcttctgggcctgctg 3 tctcatttggttccgatccaggtt; and MCP-5: 5 ccacacttctatgcctcctg 3 gctgcttgtgattctcctgt. .. Statistical analysis was performed using |